Day 25: Using Microscopes/Chapter 6

Today we learnt how to properly use  microscopes while learning about cells. We looked at some really cool things. We looked at our cheek cells, plant cells, and cells from the creatures from our aquarium.

Here is a picture from the digital microscope we have and it shows the chloroplast in the plant cells.

Chapter 6 from Your Innner Fish was about how scientists like von Baer and Haeckel studyed embroylogy. embroyology is the study of embroyos whic we briefly discussed in the study of evolution and how embryos at an early stage in a lot of life forms shows the close links between us and pigs for example. There can be three layers to an embroy the endoderm, the mesoderm, and the ectoderm. Each layer is where diferrent organs start to develop from that starts at four weeks after
conception.

A embryologist named Spemann later experimented with embryos and found something really
intresting.He split an embryo of a newt and sepreated it and found that in both pieces a complete viable newt grew. Later his student Mangold cut a piece off of an embroyo that contained the important three germ layer. Mangold moved it and a newt  was formed with two heads. This patch was known as the organizer. People then later looked at DNA especially in flies and saw that the DNA was organized. There was points where there is DNA for devleopment like for the head and then the body all in an order. They looked at this sequence and it was nearly identical in every species and the sequence is called homeobox and the eight genes that contain this homeobox are called hox genes. Scientists were looking for these hox genes in a frog and noticied a gene in the organizer that affect embryo development. Another gene was found called Noggin that did what the organizer did and duplicated a head on a species. Noggen and the hox genes play a role in the organizer.

This is what the newt can look like after the organizer gene is transplanted:

Day 24: Unit 4 Test

We took a test today that included:

• mendelian genetics
• monohybrid crosses 
• dihybrid crosses
• pedigrees
• sex-linked genetics 
• meiosis (brief)

Day 23: Pedigrees

We learned how to analyze the pedigrees of generations to discover whether a condition is sex-linked or autosomal.

This is an example of a pedigree they use roman numerals on the side for each generation and numbers left to right. This pedigree is autosomal because the number affected is not higher than 50% in offspring of the a certain sex. It is also recessive because none of the II offspring showed this trait.

Day 22: Sex-linked genetics

Sex-linked genetics is when an gene is passed on thru the male or female parent (linked to the chromosomes) to the new generations and can be found on the X chromosome for example when a black female (X^B X^B) and an orange male cat (X^bY) are crossed. The result would be a tortoise shell female or a black male because of this offspring possibilities produced:

XBXb	XBXb
XBY	XBY

Day 21: Dihybrid in Genetics

Dihybrid crossing of alleles is when there are two traits that each parent has. For example in flies there can be a yellow body color that is dominant allele( B) or a black color that is recessive (b) and there can be a red eye color that is dominant (E) and a black eye color that is recessive (e). This picture is the cross of the F1 generation of parents with heterozygous mixes of the body color and eye colors BbEe and BbEe.

Monohybrid crosses in Mendelian Genetics

Today in class we practiced monohybrid crosses of genes and alleles. They can look like this:

or like this:

It doesn't really matter which direction this four square is turned the outcomes will be the same. In these two examples the cross was between heterozygous genes which are a mix of a dominant and a recessive allele (this is review from the Hardy-Weinberg). This monohybrid cross of genes however can be between homozygous recessive (aa) and dominant (AA) as well.

There are phenotype ratios which are 3:1 for the heterozygous examples shown above because three displayed a purple flower or a smooth pea and one did not.

The genotype ratio, however was 1:2:1 this means there are one set homozygous for dominant alleles and there is two heterozygous and one for a set of homozygous recessive alleles.

Day 19: Test Day

Today we were tested on the following subjects:

• The journey of man video 
• protein synthesis
• operon system
• jumping genes
• pGlo 
• Hardy-Weinberg (review)
• biotechnology 
• DNA structure 
• DNA replication 

Day 18: Operon System

Today we reviewed the Operon system.

Here are the notes for the operon system:

• It ties in nicely with protein synthesis
• These are used because we don't always want to use our energy to constantly make proteins and mRNA.

There are two types of operon systems one is a repressible system and one is a inducible system.

The repressible one is a switch from on to off. When a system is on that means that RNA polymearse is working and the DNA is getting transcribed and translated and proteins are being created. At the beginning of this system there is a promotor and there is an operator. This operator in a repressible operon system is at first is unlocked. Because it is unlocked and mRNA and proteins are created polypeptides called tryptophan is made and then this makes the inactive repressor switch to active which goes into the operator and blocks and locks it so there is no more tryptophan or proteins or mRNA being created.

The inducible system is a switch from off to on and the operator is already blocked and locked. The system therefore can't let RNA polymearse pass thru to do protein synthesis. There is an active repressor working to block the RNA. However, when something like lactose becomes present then it will travel to the repressor and "bug" it and turn the repressor into a shape that doesn't fit into the lock box and therefore it is booted out of the operator and the RNA polymearse can once again function. The DNA once again can be transcribed and translated and enzymes can be produced such as lactase the enzyme that eats up lactose. Once lactase digests the lactose then the repressor becomes active again.

It really depends on what our bodies want to produce and what we need.

Day 17: Protein Synthesis

We learnt about and reviewed protein synthesis. This is when the DNA changes to mRNA (m=messenger RNA) which can change into protein. The DNA is transcribed into pre-mRNA but it is too big to fit through the permeable nuclear pore so therefore it goes through processing and becomes mRNA so it can move outside the nucleus to the cytoplasm. It is important to remember that strands of mRNA is different because it has in place of thymine a uracil. A now bonds with a U. Each three of these nitrogen bases in a strand are known as a codon. We need an RNA polymearse enzyme to be able to create mRNA. The promoter is the start of the reading of the RNA from 3' to 5'. Transcription factors encourage the polymearse to begin reading the DNA to mRNA and transcribe it. To work on RNA processing we add a cap to the 5' end that protects it and we add a Poly- A tail (made out of a lot of adenines) that prevents enzymes in the cytoplasm from eating away at the RNA. We also add a G-cap to the 3' end which serves the same function but is made out of guanine.There is a coding segment in between that consists of introns and exons in pre-mRNA. The introns are non coding like we read about in Survival of the Sickest. We don't want that stuff in our RNA so introns are cut out and exons are spliced together. They are spliced together with something called a spilceosome. In translation the strand of RNA is being read from 5' to 3' and the codons are accessible in the ribosome so that tRNA (the bus system) moves the amino acids and with anti-codons attach themselves. The amino acids form a polypeptide behind it.  The amino acid attaches to the tRNA using an enzyme called aminoacyl- tRNA synthetase using ATP. It enters going 5' to 3' and moves along each "station" (3 sites) until it reaches the last base on the codon and then exits already dropping the polypeptide to go pick up another one. The original starting codon (5' to 3') is always coded AUG and gets matched up with a tRNA that has a polypeptide called Metanine that is the first amino acid. It creates a long strand of amino acids as everything shifts and becomes polypeptides using GTP. It finally hits a stop codon which is going to have bases UGA, UAG or UAA. The ribosome then accepts a new protein and this is the release factor and the polypeptide releases and the tRNA. Then the whole process starts over again and the polypeptides can be used to form proteins and then a globular protein.

The protein synthesis coding can look like this:

Your original Strand of DNA is this:
5' ATGCCGAGATTAGAGATTAGTGA 3'

Then the strand is replicated
 3' TACGGCTCTAATCTCTAATCACT 5'

The mRNA will then compliment the replicated strand and look like this:
5' AUGCCGAGAUUAGAGAUUAGUGA 3'

The tRNA would compliment that as well and use the anti codons:

3' UACGGCUCUCAAUCUCUAAUCACU 5'

The amino acids that would be produced:

MET (starting amino acid always) PRO ARG VAL GLU ASP STOP

Day 16: Chapter 6 and Chapter 14 applied

As we read in the Survival of the Sickest there is a presence of jumping genes in our DNA. These jumping genes can be "cut and pasted" DNA that forms mutations. This could be a mutation that occurred and was inherited.  This flower probably went through a genetic shift because a mutation was inserted and interrupted a gene that was coded for the color purple, that is why there is some white there.

As we read in Chapter 4 in Your Inner Fish, there is a presence of certain DNA and tissues that are important in development, that can easily be interfered with. This is a hand that yielded similar results to an experiment Mary Gasseling did. Mary Gasseling conducted an experiment where she took a little patch of tissue from the pinky side of what will be a hand and transplanted it on the other side under where the index finger will form. The result was that the hand an another set of digits that were a direct mirror image. This patch of tissue that is critical in development was named the Zone of Polarizing Activity (ZPA). Looking further into this concept of ZPA scientists searched for the gene that controls the ZPA. They saw one fruit fly gene that was similar to the development of fingers in order. This gene was named hedgehog and it made one part of the body look different. They happened to find this gene in other species like a chicken. They named the chicken version of the gene sonic hedgehog. They then attached a dye color to the gene and found that it was active in the limb in the ZPA area. Every animal's limb contains sonic hedgehog and if it didn't develop properly you would have extra fingers like the picture or your pinky and thumb would be the same.

Day 15: The structure of DNA definitions of enzymes

Today we learned more about the structure of DNA. We learned that DNA can be split like with an enzyme called helicase and then use other enzymes to create a new strand using RNA. Here are the definitions of the differnt enzymes used.

Helicase- seperate strands of DNA by breaking the hydrogen bonds in between the nucleotide bases. It also uses energy from hydrolysis.

DNA Polymearse  I - This is an enzyme that participates in the replication of DNA. When the replication process takes place this enzyme removes the RNA primase and fills in different nucleotides in between the Okazaki fragments and this moves in the 5' to 3' direction.

DNA Polymearse III - This enzyme is involved in replication as well and has proofreading capabilities that works 3' to 5' and this enzyme also works at the replication fork.

RNA Primase - This is an enzyme that is important in the replication in DNA because no DNA polymearse can function as a starter key for the synthesis of a DNA strand. You always need this enzyme to function after the RNA segments are elongated by DNA polymerase.

Ligase- This enzyme is the catalyse for the joining of two large molecules and it forms a new chemical bond between them. This is usually accompanied by hydrolysis (adding water) to the smaller chemical groups that rely on one of the larger molecules.

Day 14: DNA and Chapter 6

In class we went over the structure of DNA and things like how Guanine (G) is always bonded with Cytosine (C) and how adenine (A) is always bonded with thymine (T). The bonds between  C and G and A and T are intermolecular hydrogen bonds. Double class rings such as guanine and adenine form are classified as purines. Pyrmides are referring to the single ring class such as thymine and cystosine.

For Homework we read chapter 6 of The Survival of the Sickest.

I learned that Edward Jenner from England was the first person to create a vaccine. He noticed that in milkmaids that have cowpox they can be resistant to the disease small pox. He scraped a bit of the infection of cowpox and used it as a vaccine applied to resist small box. Less harmful viruses the body won't notice and it will stimulate immune systems to produce antibodies so when we are exposed to diseases we can defend ourselves. 3 billion pairs of nucleotides are also in zygotes to be able to construct humans. However, scientists discovered that 97% of DNA isn't actually building anything, they called this DNA "junk DNA." They thought that this DNA didn't do anything and was idle this was proved wrong and now we call this DNA "noncoding". It is critical for evolution but it doesn't actually build anything. 1/3 of our DNA can actually be a virus. We defined mutations primarily as a random shift in the sequencing when DNA was getting copied or mutations when there was radiation or powerful chemicals. We discovered that single genes actually do multiple jobs and if we kill off one then another will step in it's place. Barbara McClintock suggested that parts of the genome could actively trigger much larger shifts. DNA can be cut and pasted and mixed into a new sequence. These are called "jumping genes." DNA can be stressed to make changes by a challenge of survival. E coli is a good example of this because in an experiment  scientist starved the lactose intolerant bacteria of nothing but milk. In order for it to survive it went thru a genetic shift and mutated to be tolerant and survive. This is a hypermutation that is a increase in the mutation rate so the bacteria can produce faster. The Germ-Plasma theory is the division of all the cells in the body into two divisions. Germ Cells, which are cells that contain information that is inherited and Somatic Cells which is everything other than germ cells like red-blood cells. Mutations could never be passed thru somatic cells was a common vies, however some viruses are fond to be able to pass thru somatic to germ cells. Immune systems have antibody production which has a behavior of jumping genes. Once your body develops antibodies you will always have them. Like the antibodies that prevent you from catching measles a second time.

Day 13: Genetics

Homework Questions:
1) Gregor Mendel was important because he added to Darwin's theory of natural selection by providing more evidence. Darwin knew what happened and what was the result of a species that evolved with a trait but not how. Mendel by using his pea plants was able to display the laws of inheritance.

2)

3)  The first example of variation is point mutation. This occurs when one singe base pair changes. An example of this is when the mutation inactivates the gene for signaling the muscle to begin growing like in a smaller dog. The second example of variation is insertion. Sometimes a base pair inserts itself into the genes causing a change. An example of this is in wrinkled peas, wrinkled peas are caused by an 800 base pair insertion that changes the phenotype and genetic make up. The third example of this is a gene copy number. This is when each gene copies due to a division error. An example of this chimpanzees because they only eat green plants they contain only one gene for starch digestion but somewhere along the line of evolution we now can have up to 10 of these genes. The fourth example of variation is duplication. Duplication is when the sequences for the same base-pair genes are repeated up to 8 times or more.  An example of duplication is pigs and their colouring. The colouring of pigs with dark spots are a result of copying mistakes when sequences were duplicated and lost a base as a result. The fifth and last example of variation is regulatory changes. Regulatory changes are mutations that controls when and where genes are activated. This can shift a whole organism by altering the formation of entire body parts in the early developmental stages. An example of this is the drastic evolution from the teosinte plant to the modern corn stalk.

4) Evo-devo is the study in biology which is specific to changes in important developmental genes and their effect in evolution.

5)  The migration of humans relates to the the development of being lactose tolerant because that mutation probably occurred on the path out of Africa. The mutation probably arose in the middle east when our ancestors first settled there because they depended on milk-producing animals as their herd. This mutation led them to produce lactase and could continue drinking milk.

Notes:
The other stuff we learned from the Journey of man video was that the Y chromosome is the best place to look for genetic markers. This is because it is easier to spot mutations that don't change, unlike the X- chromosomes that tend to change a lot. Our ancestors also most likely left Africa in the middle of an ice age because this ice age caused the climate to be dry and they most likely suffered in a large drought so they had to move to places with water. Populations also developed lighter skin to absorb the essential uv radiation in cold places where they are less exposed and need to synthesize vitamin D. In reverse other people have darker skin to protect them from the harsh uv radiation in those areas. Central Asian DNA is also important to the study of races because in central asia the major population shift took place so that some people migrated to Europe and East asia. The modern day Chuchki tribe are the living survivors of generations that migrated from central asia to america, yet some stayed in eastern siberia. Bergmann's and Allen's rule is when there is a very cold climate and humans have adapted to have a smaller surface area and be short to preserve as much heat as possible and so that it won't be lost. They along with this adaption have to keep a very active life so they don't freeze. These gives answers to why are ancestors could be successful in cold climates. The first americans also arrived 15,000 years ago through land exposed due to the ice age in eastern siberia.

Day 17: The Migration of Humans Part 1

In the video called "Journey of Man" we learned that a "time machine" is essentially DNA that can help us look back into history. All of our ancestors originated in Africa around 50,000 years ago and then migrated. The tribe that is still present today that is the most genetically similar to our ancestors is the San tribe men in the Kalahari Desert. They display many of the phenotypes that races today have. A genetic marker is a mutation in chromosomes and DNA that took place in one individual and was passed down and inherited. This shows us where all our ancestors split and started having really different mutations. After starting the migration from Africa, the next place we found evidence of our ancestors being present was Australia. This is a problem because this would have been a huge distance to cover and we think that our ancestors walked along the coast to reach Australia. The problem is that there was a lot more land back then due to the ice caps being large and still very frozen. So the route they took is now underwater. Essentially though we are all descendants of early Africans. This poses the question of: Does race really exist? If we were all related to each other 50,000 years ago and our pretty genetically similar than how did race develop? The answer is in the genes of races. Scientists decided to collect data from alus. Alus are short pieces of DNA that are similar in sequence to one another. This is a class of polymorphisms. Polymorphisms are in genetics the presence of variation in a population upon which natural selection can operate. Aluses once they replicate, they can spilt and then reinsert itself into a chromosome, and once inserted those alus will become permanent for a very long time and be inherited. These alus can be analyzed and provide information for people sharing a common ancestor. Scientists took a bunch of alus data from different races and then blindly, without knowing what race corresponded to what organized them into four groups. When they “applied” the labels and discovered what sample was from what race then they saw that they sorted them by similarities and most were from the same area of the world. This has been conducted several times, all yielding similar results that we can sort data into five major groups. These groups are; Sub-Saharan Africans, Northern Africans/ Europeans, West of the Himalayas Asians, East Asians, and Native Americans.  It is easier to distinguish between people from isolated and very separated parts of the world than analysis of people in a population of one country. The one country population in comparison would be very muddled. Natural selection in evolution sets up our standards of what race is. We usually distinguish race based on pigmentation of skin that has been caused by natural selection. Africans and Aborigines in Australia may have the same pigmentation of the skin because it protects them better from the harsh sun in those areas but their alus polymorphisms are very different.. The questions this brings to light is that in society should we change things like the race questions on standardized tests to be more scientifically correct and only state 5 clear races? Should we then change the norm for referring to races based on something other than phenotypes? Polymorphisms also can have beneficial aspects such as how people with one copy of a sickle cell in the Mediterranean area can be resistant to malaria. If such things are possible can we genetically engineer to make all individuals contain beneficial polymorphisms in their genes? 

We will continue watching this video next class time.

Day 16: Unit Test 2

We took a test today, the test was on:

• the modern theory of evolution 
• homologous structures
• analogous structures
• DNA frequency evidence for evolution
• fossil evidence for evolution
• cladograms and species from a common ancestor
• the Hardy- Weinberg equilibrium 
• molecular biology evidence
• natural selection
• mutations and adaptions 

It was also on some Unit 1 questions like diffusion and macromolecules.

Day 15: Hardy-Weinberg Problems

Hardy and Weinberg came up with an idea for genetic equilibrium. In order for there to be an equilibrium in an ecosystem then there must be five present conditions.
These conditions are:

• The population must be large
• Their mating must be random
• No natural selection
• No mutations
• No immigration or emigration

After learning these things. We walked around class with a set of 2 dominant alleles and 2 recessive alleles cards. When a song stopped we had to randomly "mate" (exchange cards) with the person next to us. Then we recorded if we had homozygotes genotypes and heterozygotes for recessive or dominant or both. After recording this we proceeded to calculate the percentages of the dominant alleles and the recessive ones. After finding this out we could solve for things we didn't know using these formulas.

p + q  = 1

p^2 + 2pq + q^2 = 1

The p represents the dominant allele like an A and the q represents the recessive allele an a. Therefore the 2pq is 2 times the heterogenous genotype.

This is important because we can determine the genotypes in a population if we know some minor information about the alleles.

Day 14: Parents Day and Natural Selection in Humans

Today we discussed with our parents natural selection in humans. There has been many studies done about what is preferred in the looks of women and men. What has been scientifically discovered is that women prefer men that have more feminine features because it makes them appear "friendlier" and as a "good parent." They will more likely marry them because they supposedly will be a good parent. Men also prefer women with more feminine features because they feel less threatened in masculinity and the women appear also as "better parents." Thus women naturally selected the stronger better mates to have children with. Males also feel that looking at other males with more feminine features more agreeable because they don't threaten their masculinity.

Here are composite faces that were created out of average faces. Pay attention to the physical characteristics of these people.

Day 13: The Brine Shrimp and Evolution

We started our brine shrimp lab today and talked about evolution and natural selection.

Adaptation: Is a helpful trait that a species has developed over generations.

If a species has an adaptation it is more likely to survive because it has strong traits and the weaker ones will die off. Thus this creates natural selection, the strong species that remain can only breed with each other and therefore survive keeping a "helpful" mutation.

Brine shrimps have adaptations that are different from the other species of shrimp and branchiopods.

We had "dormant" freezer brine shrimp eggs and put them in different solutions of NaCl and de-chlorinated water (0%,.5%,1.0%,1.5%,2.0%). Putting them in the water activates them to hatch under certain conditions. We put a lot of eggs in all the solutions but I predict that they won't all hatch. I also don't think that any of them will hatch in the 0% because there is not enough nutrients in that water for the shrimp.

We have to check on them in 24 hours to see which ones have hatched.

Day 12: Favism

Today we talked about Favism and how it is a specific genetic mutation.

Favism is a modern medical disease. It was first noticed after the Korean war when soldiers were taking a drug called primaquine to not risk catching malaria and this caused them to die suddenly. This is because some of the soldiers had Favism which is a deficiency mutation on the X chromosome. This is more common in men because they only have one X chromosome unlike women who have two X chromosomes so it is less likely to affect them. The deficiency mutation is when the cells lack an important enzyme called G6PD which acts like a "bouncer" for all the free radicals that seek red blood cells and attack them. If you don't have enough G6PD then free radicals can attack your blood cells and make them burst. Eating fava beans releases  free radicals in the form of covicine and vicine  that attack the cells that don't have enough G6PD and the person can die. G6PD deficiency occurs a lot in the places were fava beans are part of the staple diet which is where they are grown in the Mediterranean area. Malaria parasites do not like G6PD deficient cells so they won't attack them. So it is favored to eat fava beans for anti-malaria protection. That is why the malaria medicine also has a lot of free radicals.

Other Plants like fava beans release chemicals sometimes that serves as a defense. For example in the cassava plant if you eat it raw you will die from the cyanide produced in the skin. It produces cyanide to be protected from being predated upon a lot. Cassava will also produce a lot of cyanide in drought because it wants to survive till the next rain. In chili peppers their defense is the spicy capascin that discourages animals to eat it. The animals can't handle the taste so they won't eat the chili peppers. The peppers don't want to be eaten by the mammals because their stomach is a bad condition for their seeds to survive and get excreted and "planted" in another area. Birds on the other hand don't taste this capascin so they are "allowed" to eat the chili so they can carry their seeds in their weak digestive system.

Day 11: Evolution and DNA Lab

Here are my answers to the Quiz

Block: B

Honors Biology

Evidence of Evolution Quiz

1. Explain the following picture in terms evidence for evolution.
This is an example of the fossil record and how species can show the transition and developments in evolution. This is usually a gradual change and many species evolving from each other that have been discovered in fossils can show this. If there is a missing link, however in the fossil line up has what seems to be a rapid change. The dog- like creature in this picture is shown how slowly he evolved into a whale from many different forms.

2. Which of the following continents did marsupials begin from?

The answer is E) North America.

3. Comparing a dragonfly, bird, bats - explain the type of evolution that these organisms show.
These organisms display convergent evolution. Convergent evolution is when two organisms developed similar traits and analogous structures and had a very distant ancestor with each other. They all are analogous-related species meaning that the internal structure of their bones are different but they developed the same ability in the function of those bones. This is apparent in bats and birds because their wing bones are quite different but they still have a process in flight. There are the different bone structures in number 2 and number 3 cleearly.

4. Explain how the Common Descent Lab shows DNA evidence and ancestry as

evidence for evolution. Include examples of Primates.

The Common Descent Lab showed specific DNA evidence because we ordered the sequences of the DNA exactly like it is in a gorilla, chimpanzee and a human and compared them. Our DNA sequences matches very closely to the chimp's DNA sequence showing that we are more closely related. For example we have 15 DNA sequence matches with a chimpanzee and 10 with a gorilla. Which means we are further related to a gorilla than a chimp. The gorilla is closer to the common ancestor because it has more matches in the DNA sequence to the ancestor's DNA.

5. Explain homology using some examples from your readings.

Homology is when the internal structure of the bones in different species are similar showing that we all evolved from a common ancestor. Some examples of this is the Tiktaalik fossil that Shubin found. Examining the arm of this fossil, we can see that the arm has the same pattern of bones that we do 1 bone to 2 bones to lots of tiny bones in the hand. They may have been different in functioning, but the internal structure is the same.

Day 10: Evolution a New Unit!

We learned about the fossil record and how fossils are made today. We discussed our homework which was to read some chapters out of Your Inner Fish which is about evolution and how the early life forms of fish progressed to being land animals, which eventually evolved to be humans.

This is a picture of the Fossil that the author Neil Shubin found in the Arctic:

This is a transitional fossil discovery. Previously to the discovery of this fossil there was discoveries of ancient fish and a discovery of a type of first reptile called Hynerpeton.

They looked for the fossils in the Arctic and Ellesmere island because of geological research and the historic continental drift showing that the tropical equator continent from 375 million years ago moved north over time. They wanted to explore an unknown region and didn't go looking in the very surveyed east region of Greenland.

The evidence found of evolution in this fossil was immense:

• In the arms of this fish it showed the transition from ray bones in a fish to the formula us humans and other mammals have which is one bone- two bones and lots of phalanges in the front. 
• The Tiktaalik had eyes on the top of his flat head unlike fish to better see with, when not always submerged. 
• The Tiktaalik's ability to push itself up is due to the movement thru the probably rough terrain and escape from predators thus developing an important factor of natural selection and evolution.

Day 9: We took a test.

We had to answer a free response on potatoes and how diffusion affects them.
Then a multiple choice section on the rest of the unit.

Day 8: Review, Quiz and Fire

Today we reviewed all the material we covered over the past few weeks.

We reviewed basic chemistry, water, and organic compounds.

We then took a quiz. The basic chemistry part covered electron configuration and the differences between a covalent bond and polar bonds. The water part covered the bonding of hydrogen and how that effects the properties of water. Then the organic compounds covered what the differences between a carb, a lipid, a protein, and nucleic acid is and how their structural isomers are.

Then there was a fire and so we had to finish class.

Day 7: Who took Jeryll's ipod?

Today we did a lab about Macromolecules and investigated a mystery in a lab. The mystery was who took Jeryll's ipod. We could discover who took his ipod by the evidence that was left behind which referred to what they ate for lunch. We had evidence B the dry and liquid form.

First we did a bunch of tests to see if the substances like vegetable oil, glucose, starch from corn or potatoes, powdered egg whites, and water have the presence of carbohydrates, lipids, nucleic acids and proteins.

This is what some of our tests looked like:

Then we did tests on the foods that the people ate like beans, pretzel, butter, jelly, fat free yogurt. We did the same tests on our evidence B.

This is what some of our tests also looked like:

Then based on all our results The evidence B best matched up with the fat free yogurt. The fat free yogurt was eaten by Ashley in the lunch break and therefore Ashley took Jeryll's ipod.

Day 6: House Case Analysis

Today in class we did our first house case, we were supposed to analyze the symptoms of an 18 year old boy and come up with the diagnosis.

His symptoms were:
Vomit
Severe Headache
Extremely tired
Confusion

And we had to come to class with the three ideas of what his problem could be. I thought he had dehydration primarily and then a concussion and then a migraine.

We got to ask questions about his details about his condition. Concussion could be ruled out because he suffered from no head injuries and migraine could be ruled out because he had no history of migraines in his family and there was no real loss of vision or sensitivity to light.

Then dehydration was ruled out by his actions. Because he drank 3 gallons of water before he ran. # gallons is too much and therefore he could be suffering from Hyponatremia. Also His serum osmolality test was a decreased number. Usually there is a osmolal gap when compounds are in high concentration. This evidence that he in took too much H₂O. 

Day 5: Graphing and Part 1/5 of the lab

Today we started of by constructing graphs out of class data and seeing how the best fit line works for all the data. The best fit line is pretty much the same for each graph. It intersects the x axis at the point of equilibrium when the solution in the dialysis tubing for example is the same molarity as the liquid outside.

Then we proceeded to do the rest of the Diffusion and Osmosis Lab.....

We did Part One with the starch and level of glucose. We put the dialysis tube which was originally clear and full of starch and glucose in the glass full of iodine and water. We saw a color change in the starch tube. Bits of the starch turned a dark blue color and looked like precipitate.

This lab part was a good example of Diffusion and Size. The starch molecules were too big so there was no real diffusion into the solution. But the glucose in the dialysis tube could go thru diffusion because it is small enough molecules to move.

We know the glucose got into the the water in the cup because we tested it with Benedict and saw a color change into orange.

The second part of the lab we took cubes of NaOH and added the element and the solution changed pink and then we let it sit. We took the cubes out later and spilt it in half. This is what it looked like:

Then we knew that some of the solution had gone into the cube of NaOH. If the white bit at the center is too big then it meant none of the nutrients of the solution didn't reach the nucleus. So therefore if the surface area was too big that is a indicator that the substance didn't soak up a lot.

Day 4: Diffusion and Osmosis Lab

Diffusion: All molecules are in motion and diffusion is the movement of molecules from an area of high concentration to an area of low concentration.

Osmosis: is a specialized type of diffusion which involves the transport if water thru a permeate membrane from a region of high concentration to a region of low concentration. Only some molecules are allowed to move thru the membrane.

Hypotonic: is a lower solute concentration(more water)
Hypertonic- is a higher solute concentration (less water)

Water moves from Hypotonic to Hypertonic

We began our lab in class

 Part 2: We were to determine the molarity of different color solutions ( red, blue, green, yellow, clear, purple) using dialysis tubes and water.

We placed one tube of each in water for 30 minutes and recorded the mass change. And then got the molarities for each:

Color	Mass Before	Mass After	Percent Change	Molarity
Clear	7.3g	7.9g	8.21%	.2M
Purple	8.1g	9.8g	20.988%	.8M
Yellow	7.6g	9.2g	21.053%	.6M
Red	8.1g	10.3g	27.162%	1M
Blue	7.3g	7.3g	0%	0M
Green	7.4g	8.4g	13.514%	.4M

This is what the tubes looked like afterward they were all more full after other than blue which didn't fill:

We also set up our energy drink (powerade experiment) and we saw what happened to them later that night.

This is what the powerade dialysis tubes looked like when we placed them in the cups of the different color solutions:

This is what the powerade tubes looked like after several hours and there was a color change and a decrease in mass:

 This was the percent mass change for the powerade:

Blue: 9.83%

Clear: -4.91%

Green:-22.95%

Yellow:-32.72%

Purple:-32.75%

Red:-54.09%

The other pair in our group Chris and Daniel peeled potatoes and dropped it in the solutions and waited several hours as well. This is their results:

Blue:21.95%

Clear:5.88%

Green:-36.67%

Yellow:-36%

Purple:-39.13%

Red:-66.67%