Day 17: Protein Synthesis

We learnt about and reviewed protein synthesis. This is when the DNA changes to mRNA (m=messenger RNA) which can change into protein. The DNA is transcribed into pre-mRNA but it is too big to fit through the permeable nuclear pore so therefore it goes through processing and becomes mRNA so it can move outside the nucleus to the cytoplasm. It is important to remember that strands of mRNA is different because it has in place of thymine a uracil. A now bonds with a U. Each three of these nitrogen bases in a strand are known as a codon. We need an RNA polymearse enzyme to be able to create mRNA. The promoter is the start of the reading of the RNA from 3' to 5'. Transcription factors encourage the polymearse to begin reading the DNA to mRNA and transcribe it. To work on RNA processing we add a cap to the 5' end that protects it and we add a Poly- A tail (made out of a lot of adenines) that prevents enzymes in the cytoplasm from eating away at the RNA. We also add a G-cap to the 3' end which serves the same function but is made out of guanine.There is a coding segment in between that consists of introns and exons in pre-mRNA. The introns are non coding like we read about in Survival of the Sickest. We don't want that stuff in our RNA so introns are cut out and exons are spliced together. They are spliced together with something called a spilceosome. In translation the strand of RNA is being read from 5' to 3' and the codons are accessible in the ribosome so that tRNA (the bus system) moves the amino acids and with anti-codons attach themselves. The amino acids form a polypeptide behind it.  The amino acid attaches to the tRNA using an enzyme called aminoacyl- tRNA synthetase using ATP. It enters going 5' to 3' and moves along each "station" (3 sites) until it reaches the last base on the codon and then exits already dropping the polypeptide to go pick up another one. The original starting codon (5' to 3') is always coded AUG and gets matched up with a tRNA that has a polypeptide called Metanine that is the first amino acid. It creates a long strand of amino acids as everything shifts and becomes polypeptides using GTP. It finally hits a stop codon which is going to have bases UGA, UAG or UAA. The ribosome then accepts a new protein and this is the release factor and the polypeptide releases and the tRNA. Then the whole process starts over again and the polypeptides can be used to form proteins and then a globular protein.

The protein synthesis coding can look like this:

Your original Strand of DNA is this:
5' ATGCCGAGATTAGAGATTAGTGA 3'

Then the strand is replicated
 3' TACGGCTCTAATCTCTAATCACT 5'

The mRNA will then compliment the replicated strand and look like this:
5' AUGCCGAGAUUAGAGAUUAGUGA 3'

The tRNA would compliment that as well and use the anti codons:

3' UACGGCUCUCAAUCUCUAAUCACU 5'

The amino acids that would be produced:

MET (starting amino acid always) PRO ARG VAL GLU ASP STOP