- The journey of man video
- protein synthesis
- operon system
- jumping genes
- pGlo
- Hardy-Weinberg (review)
- biotechnology
- DNA structure
- DNA replication
Monday, November 18, 2013
Day 19: Test Day
Today we were tested on the following subjects:
Monday, November 11, 2013
Day 18: Operon System
Today we reviewed the Operon system.
Here are the notes for the operon system:
The repressible one is a switch from on to off. When a system is on that means that RNA polymearse is working and the DNA is getting transcribed and translated and proteins are being created. At the beginning of this system there is a promotor and there is an operator. This operator in a repressible operon system is at first is unlocked. Because it is unlocked and mRNA and proteins are created polypeptides called tryptophan is made and then this makes the inactive repressor switch to active which goes into the operator and blocks and locks it so there is no more tryptophan or proteins or mRNA being created.
The inducible system is a switch from off to on and the operator is already blocked and locked. The system therefore can't let RNA polymearse pass thru to do protein synthesis. There is an active repressor working to block the RNA. However, when something like lactose becomes present then it will travel to the repressor and "bug" it and turn the repressor into a shape that doesn't fit into the lock box and therefore it is booted out of the operator and the RNA polymearse can once again function. The DNA once again can be transcribed and translated and enzymes can be produced such as lactase the enzyme that eats up lactose. Once lactase digests the lactose then the repressor becomes active again.
It really depends on what our bodies want to produce and what we need.
Here are the notes for the operon system:
- It ties in nicely with protein synthesis
- These are used because we don't always want to use our energy to constantly make proteins and mRNA.
The repressible one is a switch from on to off. When a system is on that means that RNA polymearse is working and the DNA is getting transcribed and translated and proteins are being created. At the beginning of this system there is a promotor and there is an operator. This operator in a repressible operon system is at first is unlocked. Because it is unlocked and mRNA and proteins are created polypeptides called tryptophan is made and then this makes the inactive repressor switch to active which goes into the operator and blocks and locks it so there is no more tryptophan or proteins or mRNA being created.
The inducible system is a switch from off to on and the operator is already blocked and locked. The system therefore can't let RNA polymearse pass thru to do protein synthesis. There is an active repressor working to block the RNA. However, when something like lactose becomes present then it will travel to the repressor and "bug" it and turn the repressor into a shape that doesn't fit into the lock box and therefore it is booted out of the operator and the RNA polymearse can once again function. The DNA once again can be transcribed and translated and enzymes can be produced such as lactase the enzyme that eats up lactose. Once lactase digests the lactose then the repressor becomes active again.
It really depends on what our bodies want to produce and what we need.
Day 17: Protein Synthesis
We learnt about and reviewed protein synthesis. This is when the DNA changes to mRNA (m=messenger RNA) which can change into protein. The DNA is transcribed into pre-mRNA but it is too big to fit through the permeable nuclear pore so therefore it goes through processing and becomes mRNA so it can move outside the nucleus to the cytoplasm. It is important to remember that strands of mRNA is different because it has in place of thymine a uracil. A now bonds with a U. Each three of these nitrogen bases in a strand are known as a codon. We need an RNA polymearse enzyme to be able to create mRNA. The promoter is the start of the reading of the RNA from 3' to 5'. Transcription factors encourage the polymearse to begin reading the DNA to mRNA and transcribe it. To work on RNA processing we add a cap to the 5' end that protects it and we add a Poly- A tail (made out of a lot of adenines) that prevents enzymes in the cytoplasm from eating away at the RNA. We also add a G-cap to the 3' end which serves the same function but is made out of guanine.There is a coding segment in between that consists of introns and exons in pre-mRNA. The introns are non coding like we read about in Survival of the Sickest. We don't want that stuff in our RNA so introns are cut out and exons are spliced together. They are spliced together with something called a spilceosome. In translation the strand of RNA is being read from 5' to 3' and the codons are accessible in the ribosome so that tRNA (the bus system) moves the amino acids and with anti-codons attach themselves. The amino acids form a polypeptide behind it. The amino acid attaches to the tRNA using an enzyme called aminoacyl- tRNA synthetase using ATP. It enters going 5' to 3' and moves along each "station" (3 sites) until it reaches the last base on the codon and then exits already dropping the polypeptide to go pick up another one. The original starting codon (5' to 3') is always coded AUG and gets matched up with a tRNA that has a polypeptide called Metanine that is the first amino acid. It creates a long strand of amino acids as everything shifts and becomes polypeptides using GTP. It finally hits a stop codon which is going to have bases UGA, UAG or UAA. The ribosome then accepts a new protein and this is the release factor and the polypeptide releases and the tRNA. Then the whole process starts over again and the polypeptides can be used to form proteins and then a globular protein.
The protein synthesis coding can look like this:
Your original Strand of DNA is this:
5' ATGCCGAGATTAGAGATTAGTGA 3'
Then the strand is replicated
3' TACGGCTCTAATCTCTAATCACT 5'
The mRNA will then compliment the replicated strand and look like this:
5' AUGCCGAGAUUAGAGAUUAGUGA 3'
The tRNA would compliment that as well and use the anti codons:
3' UACGGCUCUCAAUCUCUAAUCACU 5'
The amino acids that would be produced:
MET (starting amino acid always) PRO ARG VAL GLU ASP STOP
The protein synthesis coding can look like this:
Your original Strand of DNA is this:
5' ATGCCGAGATTAGAGATTAGTGA 3'
Then the strand is replicated
3' TACGGCTCTAATCTCTAATCACT 5'
The mRNA will then compliment the replicated strand and look like this:
5' AUGCCGAGAUUAGAGAUUAGUGA 3'
The tRNA would compliment that as well and use the anti codons:
3' UACGGCUCUCAAUCUCUAAUCACU 5'
The amino acids that would be produced:
MET (starting amino acid always) PRO ARG VAL GLU ASP STOP
Day 16: Chapter 6 and Chapter 14 applied
As we read in the Survival of the Sickest there is a presence of jumping genes in our DNA. These jumping genes can be "cut and pasted" DNA that forms mutations. This could be a mutation that occurred and was inherited. This flower probably went through a genetic shift because a mutation was inserted and interrupted a gene that was coded for the color purple, that is why there is some white there.
As we read in Chapter 4 in Your Inner Fish, there is a presence of certain DNA and tissues that are important in development, that can easily be interfered with. This is a hand that yielded similar results to an experiment Mary Gasseling did. Mary Gasseling conducted an experiment where she took a little patch of tissue from the pinky side of what will be a hand and transplanted it on the other side under where the index finger will form. The result was that the hand an another set of digits that were a direct mirror image. This patch of tissue that is critical in development was named the Zone of Polarizing Activity (ZPA). Looking further into this concept of ZPA scientists searched for the gene that controls the ZPA. They saw one fruit fly gene that was similar to the development of fingers in order. This gene was named hedgehog and it made one part of the body look different. They happened to find this gene in other species like a chicken. They named the chicken version of the gene sonic hedgehog. They then attached a dye color to the gene and found that it was active in the limb in the ZPA area. Every animal's limb contains sonic hedgehog and if it didn't develop properly you would have extra fingers like the picture or your pinky and thumb would be the same.
Tuesday, November 5, 2013
Day 15: The structure of DNA definitions of enzymes
Today we learned more about the structure of DNA. We learned that DNA can be split like with an enzyme called helicase and then use other enzymes to create a new strand using RNA. Here are the definitions of the differnt enzymes used.
Helicase- seperate strands of DNA by breaking the hydrogen bonds in between the nucleotide bases. It also uses energy from hydrolysis.
DNA Polymearse I - This is an enzyme that participates in the replication of DNA. When the replication process takes place this enzyme removes the RNA primase and fills in different nucleotides in between the Okazaki fragments and this moves in the 5' to 3' direction.
DNA Polymearse III - This enzyme is involved in replication as well and has proofreading capabilities that works 3' to 5' and this enzyme also works at the replication fork.
RNA Primase - This is an enzyme that is important in the replication in DNA because no DNA polymearse can function as a starter key for the synthesis of a DNA strand. You always need this enzyme to function after the RNA segments are elongated by DNA polymerase.
Ligase- This enzyme is the catalyse for the joining of two large molecules and it forms a new chemical bond between them. This is usually accompanied by hydrolysis (adding water) to the smaller chemical groups that rely on one of the larger molecules.
Helicase- seperate strands of DNA by breaking the hydrogen bonds in between the nucleotide bases. It also uses energy from hydrolysis.
DNA Polymearse I - This is an enzyme that participates in the replication of DNA. When the replication process takes place this enzyme removes the RNA primase and fills in different nucleotides in between the Okazaki fragments and this moves in the 5' to 3' direction.
DNA Polymearse III - This enzyme is involved in replication as well and has proofreading capabilities that works 3' to 5' and this enzyme also works at the replication fork.
RNA Primase - This is an enzyme that is important in the replication in DNA because no DNA polymearse can function as a starter key for the synthesis of a DNA strand. You always need this enzyme to function after the RNA segments are elongated by DNA polymerase.
Ligase- This enzyme is the catalyse for the joining of two large molecules and it forms a new chemical bond between them. This is usually accompanied by hydrolysis (adding water) to the smaller chemical groups that rely on one of the larger molecules.
Subscribe to:
Posts (Atom)


